/zellig/ - Ongezellig

>>55114
pic entirely unrelated btw but the guy who posted it has a bunch of good zellig fanart on xitter, his names in the bottom corner

>>55115
oh wait i only saved the thumbnail so the image has 3 pixels, maybe i am retarded

>>55118
COCO IS NOT A RACIST! SHE IS A KIND GIRL WHO RESPECTS EVERYONE!

>>55119
COCO IS A RACIST! SHE IS A CRUEL GIRL WHO DESPISES EVERYONE!

>>55114
oh also that "agugu" shit is not even remotely funny, its just your thinly veiled ageplay fetish. you people are worse than twitter users

Bait thread

>>55123
not bait, these are my genuine feelings on this topic

agugu

OP is a faggot cuck who has normgroid friends instead of keyed super aryan chudcel crewmates that laugh at those who are lesser than them.

>>55127
i do laugh at people lesser than me. like you!
>nothing ever happens
this is true tho

embedded 1

>>>55128
>I am not le heckin' racist like (You)
>knows about NEH
Xitter immigrant spotted

>>55129
wtf is this how did you do that

>>55131
what the fuck is NEH
also i dont use twitter, unless you want to count using nitter to look for zellig art and a few other things

>>55133
you can't embed googs yet, only I can

>>55135
Zoot award
>>55134
Where do you even come from then

>>55136
ok full honesty moment. i have been a sharty user for over a year and found out about zellig through that. i have participated in plenty of raids (mostly jackbox) and posted plenty of antitroon stuff, despite in reality being a leftist who is anti racist and supports trans rights?
>how does that even work
cognitive dissonance idfk

>>55137
also yes this post was bait but also partially honest because i am actually not a chud

Its infected.

>>55137
>>55138
Is this the tranny that set that agugu image on fire

>>55141
No, it's not me

I'am not the OP.

>>55141
brother i have no idea what you're talking about. i dont use the zarty and i havent even visited the site in months

>>55143
proof before the samefagging niggers come

agagagagagawa

The baiter or the naive, call him.

>>55152
NOT EVERYTHING HAS TO DO WITH YOUR OBSESSION WITH RACIAL POLITICS, YOU OBSESSED FAGGOTS

>>55153
Race is everything. Blut und Boden

>>55154
race is literally nothing. not only it is arbitrary, (the definition of white has changed a lot over time), but "racial interests" arent a thing. there are only class interests, and the working man has no nation

>>55155
The worst bait ever or the evidence of missed biology classes in school, call it.

White race is arbitrary as long as you don't know what genetics and anthropology are

>>55162
Geeeeeeg what is this bait, call me when you'll be able to solve the totally not racially related problem of bone marrow transplants

>>55161
>anthropology
a zulu and somali share little if any cultural similarity, yet both are categorized as "black" based on the fact that they share a general skin tone and nothing else. also, if your racial classifications are as objective as you claim, why have they changed so much, not just over time, but between cultures

>>55156
finally some leftoid to redpill. it was getting boring lately. class warfare is a race warfare. man works not for himself but for welfare of his family and his own people, which belong to his nation.
>>55160
unity under common religion above other distinctions does not negate these distinctions.

>>55166
ive meant to respond to >>55155 not >>55156 sorry

>>55166
>his people
an entirely arbitrary idea. say you're a german, if ypou were alive in the 1700s, youd likely classify all citizens of whatever german kingdom you came from as your "people". later on, in the 1800s/early 1900s, the definition probably broadened to all germans. then, if you bough into nazi beliefs, it wouldve broadened even further into the "aryan race". now, you say it is "white people", a definition that includes plenty of people, like slavs, who nazis thought of as non aryan subhumans to be exterminated

when making an argument that races don't exist, just try not to simultaneously deny the existence of colours (as in on the electromagnetic spectrum)

>>55170
yeah i share this hatred for leftists, which is why im a communist. most of them have no priniciples, only vibes (this is true of rightists too doebeit). see "nationalism LE BAD except palestine because ummmmm shut up ok?"

>>55171
so yeah i also disagree black nationalism, it completely ignores class differences and thinks of "black people" as some homogenous category that all share the same interests, just like you guys with white people

>>55166
anyone ur probably not gonna redpill me ive been browsing 4cucks /pol/ for months and every single argument ive seen, without exception, has been so extraodinarily retarded it has kept me interested enough to keep browsing

>>55160
Adam and Eve were white. Europeans are the only pure descendants of genetically West Eurasian populations and thus the only veritable image of God. Arabs are the mongrels who are the result of the ancient racemixing event in Northern Africa, when a population, closest to modern Southern Europeans (Sardinians), aka Dzudzuana intermixed with Negroes after several cases of racial conflicts there. The same history with Iranians, Caucasians and so on. They are not fully human, as well as EE and SSA aren't human at all (just the beasts of the field, like Khoisans). Don't even try to pretend that the Scripture contradicts science and vice verse.
>>55165
>Skin tone
All nons have thick skin, while whites have thin. So the thickness of the skin also matters.
>And nothing else
I could list a lot of parameters if I dig around, but I should ask first, do you know what prognathism is?
>>55166
Ruzzoid shut up, nobody will listen to 3rd worldist who hates the West. Remember Ongezellig is a western invention.
>>55172
Yes, genetically close people share the same biological interests due to that fact they share the same genes, it's not a secret. And that's why altruism exists. And that's why altruism is "racist", as the latest researches and thousands of years of experience show.

>>55168
>an entirely arbitrary idea
there is nothing arbitrary about this. definition broadens only as a pragmatical measure as a smiliar people rally for the necessity of survival. but still without a semitic power structure people naturally tend to unite in a smallest possible homogenous group required for survival. which in a modern technological societies is a nation.
>like slavs, who nazis thought of as non aryan subhumans to be exterminated
where? did you even read the mein kampf? or do you believe in a "witnesses" of definitely not tortured ss-men? generalplan ost was completely distorted by allies after they conquered germany and started a mock trials.
>>55171
>which is why im a communist
and you support leaders of soviet union except for some weird reason Stalin?

>>55168
Nazis considered Slavics as "Aryans" (= Whites), but in properly scientific meaning the Aryans were the ancient population whose ancestry doesn't correlate with whiteness as such but rather with northerness (germanic and slavic people, for example). Back to the topic, considering Slavics as Whites was the main reason that included them in the future "Neue Europe".
>>55173
>browsing /pol/ to find arguments
Biggest retard of 2025 award…

>>55175
>Yes, genetically close people share the same biological interests due to that fact they share the same genes, it's not a secret. And that's why altruism exists. And that's why altruism is "racist", as the latest researches and thousands of years of experience show.
what are even on about, humans dont have magic gene detectors that tell them who to trust and who not too, and even if they did, how do you explain the hundreds or even thousands of years of war between people you classify as the "same race". these classifications are clearly socially constructed, if you went back even 150 years and told a european that there was one "white race" to which russians, the english, and italians all equally belong, they wouldve looked at you like you were a lunatic

>>55177
>>>browsing /pol/ to find arguments
not why i went there initially, it was election season in muttland and i figured that place had to be full of even more baitable retards than usual and holy fuck was i right. literally the easiest (you)'s ive ever gotten

Let's be fair, there's no such thing as a class warfare. Social status is a reflection of ingroup eugenic quality. The rich are somewhat better than the poor, but there would be no existential conflict if they are of the same race.

>>55180
>class conflict doesnt exist if they're of the same race!
never picked up a history book award

>>55175
>Remember Ongezellig is a western invention
Similarly Goethes Faust is a western invention and yet everyone in my circle is required to understand it properly. It is you westoids who have a problem with stuff outside of your small eurocentric bubble.

At least 50% of the posts in this thread are made by brown hands

>>55178
>what are even on about, humans dont have magic gene detectors that tell them who to trust and who not too, and even if they did, how do you explain the hundreds or even thousands of years of war between people you classify as the "same race".
This part is almost true, the differences are noticed when they become visible, for instance children will prefer to play with other children of the same race unless indoctrinated into thinking it's morally wrong.
>these classifications are clearly socially constructed, if you went back even 150 years and told a european that there was one "white race" to which russians, the english, and italians all equally belong, they wouldve looked at you like you were a lunatic
Words are socially constructed, the genetic phenomena they refer to are not. You could try to use the same argument against the existence of galaxies, black holes etc.

>>55177
>included them in the future "Neue Europe"
find me 1 nazi policy supporting the idea that slavs were going to be part of the glorious thousand year reich. just 1

>>55178
>what are even on about, humans dont have magic gene detectors that tell them who to trust and who not too
Because it's unconscious, lol.
>And even if they did, how do you explain the hundreds or even thousands of years of war between people you classify as the "same race".
Small disagreements of non-existential character.
>these classifications are clearly socially constructed
Since biology builds society, right.
>if you went back even 150 years and told a european that there was one "white race" to which russians, the english, and italians all equally belong, they wouldve looked at you like you were a lunatic
Wrong, they just classified the english and other germanic people (aka so-called "nordics") as the most superior white group among ones.

>>55175
Christianity is false because some races are better than the other

>>55181
>Evendoe communism invented by foreign racial elements in order to destroy Europe
Do you transheart (((Marx))) or something?

>>55184
>You could try to use the same argument against the existence of galaxies, black holes etc.
false equivalence. the view of italians as non-white did not change in america because of some new genetic finding that was published and then distributed until the public accepted it, but by what was essentially a culture wide vibe shift that took decades

>>55182
Being eurocentric is keyed geg

>>55185
Heim im Reich

>>55181
Class conflict is between useful producers and a useless wealth hoarders. Such as conflict between an industry and banks. Not between a meaningless "proletariat" which doesn't even exist anymore, replaced with skilled workers or exported to a foreign countries, in which case struggle stops being economic and becomes national, and a "capitalist" boogeyman.

>>55188
>dismisses anything that disagrees with you out of hand because "da jooz"
this is why i never argue with you people, i usually just post my bait and fuck off. but im sleep deprived and my mind is not functioning at 100% power

>>55187
Christianity is white only religion although. Remember Geloftedag, kaffer.

>>55189
I'm not talking about the views of any particular people (especially Americans), the fact that some number of people believes in some fact doesn't automatically make it true (or false). For instance, there are more than a billion of Muslims who believe they will be eternally damned if they eat pork.

>>55192
I wonder from which tribe those at the top belong to

>>55192
>the proletariat doesnt exist anymore
oh im sorry, has wage labour been abolished? the accumulation of capital been ended?

>>55193
Since Marxism is aimed at immoral dysgenic social stratas, it's obvious I won't consider those
>>55197
Just say you're envy to the rich. Is it so difficult, ha?
as an argument.

>>55196
some are white, some jewish, some asian, some black, all perform the same function and have the same interests because of their shared class. the idea that the working class is treated better when they have the same skin tone as the bourgeoisie is pure lunacy that a simple look at any history textbook or even modern conditions will disprove

>>55198
Sorry for the fail, one reply splitted the previous in two

>>55199
And all of them bow to one group, curious, isn't it?

>>55194
blasphemy

>>55202
Also
>Jews make up 0.2% of the world, yet 18% of the top 50 billionaires.
Curious!

>>55198
>envious of the rich
this more easily applies to you. you are jealous of the ruling class you think is jewish and want to replace it with a 100% white one, which you hope will include you. i hope to get rid of class society altogether since it is next stage in historical development after capitalism, just as capitalism came after feudalism

>>55202
this isnt even true but im not gonna fight over the point because its moot. i dont care who they bow too, i care about their existence as a class

>>55203
Sowwy chud, I don't consider internationalist byzantine crap as a good example of Christianity.

>>55189
Do galaxies exist? You could say that they do not, there are only stars and some of them just happen to be closer to each other, but to assign any meaning to that fact is a human decision. Yet there are phenomena like the rotation of galaxies that are easier to explain if we assume the existence of galaxies than if we do not. The value of every theory lies in its predictive power.
>>55204
>The genetic differences exist unless they are differences between Whites and Jews, then it's a conspiracy.

>>55208
race as we currently understand definitely is not the greatest framework for looking at genetics. the simple categories of "black", "white", "asian" etc. come nowhere close to providing an adequate lense for looking at genetic differences, because their socially constructed categories based on simple factors like skin tone, which are shared in population as disparate as sub-saharan africans and aboriginal australians

>>55207
God loves all and you are committing absolute blasphemy.

So, what if a worker becomes a "capitalist", i.e. becomes richer? Will it change his class interests? If it will, then every single person on the planet is just selfish and unscrupulous egoist. Very optimistic, leftie sister. But there remains one question: why then morals and ethics exist? The question leftards will never answer.

>>55196
Obviously they are semitic. And this is why I always say that class warfare is a race warfare.
>>55197
Most people either own the means of production or are skilled enough to be in a class of skilled technicians who are different from proletariat. You cannot have your larpy commie revolution with starbucks employees.
>>55199
No. Banker power is specifically jewish power.
>>55205
You have progressive view of history which is obviously false if you look at it outside of westoid perspective. I dont want to go into discussion about it so I will just say that everyone who actually oposes semitic power structure cares about economy in some respects too. Jewish banking and financial advisory like blackrock hold way more power than your boogeyman "industrial capitalist". And they were specifically targeted by actual nationalist and socialist countries like Stalin's Russia, German Reich and Libya

>>55210
He doesn't love those who poses a biological danger to His unique and chosen seed of Adam.

>>55208
>since you're made out of cells that just happen to be close to each other, humans don't exist
>since trees just happen to be close to each other, forests don't exist
>since buildings just happen to be close to each other, cities don't exist
Everyone knows what every single thing I mentioned here is and most importantly looks like, because these things exist. Correlating the use of an arbitrary word and that of something that actually exists (a forest is still a group of trees, even if you call it something else) just shows a lack of understanding (or voluntary one) of the reality that surrounds you.
>>The genetic differences exist unless they are differences between Whites and Jews, then it's a conspiracy.
This doesn't make any sense, Jews being the majority of billionaires is not a conspiracy

>>55211
>Will it change his class interests
yes! class isnt some inherent quality that people posess, it can and does change.
>why then morals and ethics exist
marx thought that morals were socially defined and did nto come from some divine source

>>55208
Jews aren't whites. Even soycilians are whiter.

>>55212
>Banker power is specifically jewish power
and what if every jewish banker were simultaneously replaced with a white one? would they be "nicer" to us? you are living in a fantasy world

>>55114
Some nigga on the sharty decided to promote this show, it popped off due to how good and relatable the characters are and due to containing right wing themes and European history, it got a lot of 'teens attention and eventually this place was made to house all the chuddy fans of the show.
We've done a lot to strengthen our grip (doxxes, raids, the reanimation collab, etc…) Most of this is due to how Massa has seemingly gone "woke" (prob just distanced himself from the right wing stuff) and we're basically at war with the ongezellig 'cord and subreddits.
For the racism side, Idrc to explain, but I am a centrist.

>>55215
>yes! class isnt some inherent quality that people posess, it can and does change.
Then why the changeable features are more important than the inherent ones? Isn't this assumption simply… Dumb and retarded? I just see all commies hate nature for no actual reason.
>marx thought that morals were socially defined and did nto come from some divine source
Yes, morals are socially defined. Racially, even. What's the problem? Why I can't call inherent and immutable interests of my blood "divine" and "high" compared to the interests which are formless and ever-changing?

me agugu, me hate kikes

waaaawawaaaah

What the hell is going on

>>55218
yeah id recommend reading through the thread replies, but tldr this is a bait thread i made and its devolved/evolved into a serious political discussion

>>55217
Jews kickstarted usury in the first place. They control the system because they started it and thus are at the top. Without Jews an actual Christianity would most likely prevail and stop usury from ever developing. If every jewish banker were simultaneously replaced with a white one then system would gradually get weaker until something could be done about it, because of smaller in-group preference.

this twead needs a gugu!

guuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu

gugugugugugugugu

so happy to see all the gugus

>>55217
>would they be "nicer" to us?
Yes, the De Medici family were powerful bankers and made Florence thrive (same thing in every other Italian city-state). Jewish bankers instead were kicked 109 times over the course of millennias. Really makes you think

>>55219
>Then why the changeable features are more important than the inherent ones?
because these are the ones that actually influence our material conditions and the way we behave
>Why I can't call inherent and immutable interests of my blood "divine" and "high" compared to the interests which are formless and ever-changing?
hey you can believe whatever you want, you can believe that you're the son of zeus or whatever, doesnt stop me from calling you a retard for believing that.

this thread is now an aguguland.online colony, post your favorite googs

GOOOOOOOOOOOOOOOG

agugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugu

Clean it up jangoog

aguguland victory

GUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU

agugucord woke up

>agugu
<agugu
^agugu

Angry goog

thread OP here, it seems that a seething spammer has arrived and ive been in this thread for way too long so i will be leaving. thanks for the argument though. reddit on!

>>55213
If you fully obey the Lord your God and carefully follow all his commands I give you today, the Lord your God will set you high above all the nations on earth. All these blessings will come on you and accompany you if you obey the Lord your God. You will be blessed in the city and blessed in the country. The fruit of your womb will be blessed, and the crops of your land and the young of your livestock—the calves of your herds and the lambs of your flocks. Your basket and your kneading trough will be blessed. You will be blessed when you come in and blessed when you go out. The Lord will grant that the enemies who rise up against you will be defeated before you. They will come at you from one direction but flee from you in seven. The Lord will send a blessing on your barns and on everything you put your hand to. The Lord your God will bless you in the land he is giving you. The Lord will establish you as his holy people, as he promised you on oath, if you keep the commands of the Lord your God and walk in obedience to him. Then all the peoples on earth will see that you are called by the name of the Lord, and they will fear you. The Lord will grant you abundant prosperity—in the fruit of your womb, the young of your livestock and the crops of your ground—in the land he swore to your ancestors to give you. The Lord will open the heavens, the storehouse of his bounty, to send rain on your land in season and to bless all the work of your hands. You will lend to many nations but will borrow from none. The Lord will make you the head, not the tail. If you pay attention to the commands of the Lord your God that I give you this day and carefully follow them, you will always be at the top, never at the bottom. Do not turn aside from any of the commands I give you today, to the right or to the left, following other gods and serving them.

However, if you do not obey the Lord your God and do not carefully follow all his commands and decrees I am giving you today, all these curses will come on you and overtake you. You will be cursed in the city and cursed in the country. Your basket and your kneading trough will be cursed. The fruit of your womb will be cursed, and the crops of your land, and the calves of your herds and the lambs of your flocks. You will be cursed when you come in and cursed when you go out. The Lord will send on you curses, confusion and rebuke in everything you put your hand to, until you are destroyed and come to sudden ruin because of the evil you have done in forsaking him. The Lord will plague you with diseases until he has destroyed you from the land you are entering to possess. The Lord will strike you with wasting disease, with fever and inflammation, with scorching heat and drought, with blight and mildew, which will plague you until you perish. The sky over your head will be bronze, the ground beneath you iron. The Lord will turn the rain of your country into dust and powder; it will come down from the skies until you are destroyed. The Lord will cause you to be defeated before your enemies. You will come at them from one direction but flee from them in seven, and you will become a thing of horror to all the kingdoms on earth. Your carcasses will be food for all the birds and the wild animals, and there will be no one to frighten them away. The Lord will afflict you with the boils of Egypt and with tumors, festering sores and the itch, from which you cannot be cured. The Lord will afflict you with madness, blindness and confusion of mind. At midday you will grope about like a blind person in the dark. You will be unsuccessful in everything you do; day after day you will be oppressed and robbed, with no one to rescue you. You will be pledged to be married to a woman, but another will take her and rape her. You will build a house, but you will not live in it. You will plant a vineyard, but you will not even begin to enjoy its fruit. Your ox will be slaughtered before your eyes, but you will eat none of it. Your donkey will be forcibly taken from you and will not be returned. Your sheep will be given to your enemies, and no one will rescue them. Your sons and daughters will be given to another nation, and you will wear out your eyes watching for them day after day, powerless to lift a hand. A people that you do not know will eat what your land and labor produce, and you will have nothing but cruel oppression all your days. The sights you see will drive you mad. The Lord will afflict your knees and legs with painful boils that cannot be cured, spreading from the soles of your feet to the top of your head. The Lord will drive you and the king you set over you to a nation unknown to you or your ancestors. There you will worship other gods, gods of wood and stone. You will become a thing of horror, a byword and an object of ridicule among all the peoples where the Lord will drive you. You will sow much seed in the field but you will harvest little, because locusts will devour it. You will plant vineyards and cultivate them but you will not drink the wine or gather the grapes, because worms will eat them. You will have olive trees throughout your country but you will not use the oil, because the olives will drop off. You will have sons and daughters but you will not keep them, because they will go into captivity. Swarms of locusts will take over all your trees and the crops of your land. The foreigners who reside among you will rise above you higher and higher, but you will sink lower and lower. They will lend to you, but you will not lend to them. They will be the head, but you will be the tail. All these curses will come on you. They will pursue you and overtake you until you are destroyed, because you did not obey the Lord your God and observe the commands and decrees he gave you. They will be a sign and a wonder to you and your descendants forever. Because you did not serve the Lord your God joyfully and gladly in the time of prosperity, therefore in hunger and thirst, in nakedness and dire poverty, you will serve the enemies the Lord sends against you. He will put an iron yoke on your neck until he has destroyed you. The Lord will bring a nation against you from far away, from the ends of the earth, like an eagle swooping down, a nation whose language you will not understand, a fierce-looking nation without respect for the old or pity for the young. They will devour the young of your livestock and the crops of your land until you are destroyed. They will leave you no grain, new wine or olive oil, nor any calves of your herds or lambs of your flocks until you are ruined. They will lay siege to all the cities throughout your land until the high fortified walls in which you trust fall down. They will besiege all the cities throughout the land the Lord your God is giving you. Because of the suffering your enemy will inflict on you during the siege, you will eat the fruit of the womb, the flesh of the sons and daughters the Lord your God has given you. Even the most gentle and sensitive man among you will have no compassion on his own brother or the wife he loves or his surviving children, and he will not give to one of them any of the flesh of his children that he is eating. It will be all he has left because of the suffering your enemy will inflict on you during the siege of all your cities. The most gentle and sensitive woman among you—so sensitive and gentle that she would not venture to touch the ground with the sole of her foot—will begrudge the husband she loves and her own son or daughter the afterbirth from her womb and the children she bears. For in her dire need she intends to eat them secretly because of the suffering your enemy will inflict on you during the siege of your cities. If you do not carefully follow all the words of this law, which are written in this book, and do not revere this glorious and awesome name—the Lord your God— the Lord will send fearful plagues on you and your descendants, harsh and prolonged disasters, and severe and lingering illnesses. He will bring on you all the diseases of Egypt that you dreaded, and they will cling to you. The Lord will also bring on you every kind of sickness and disaster not recorded in this Book of the Law, until you are destroyed. ou who were as numerous as the stars in the sky will be left but few in number, because you did not obey the Lord your God. Just as it pleased the Lord to make you prosper and increase in number, so it will please him to ruin and destroy you. You will be uprooted from the land you are entering to possess. Then the Lord will scatter you among all nations, from one end of the earth to the other. There you will worship other gods—gods of wood and stone, which neither you nor your ancestors have known. Among those nations you will find no repose, no resting place for the sole of your foot. There the Lord will give you an anxious mind, eyes weary with longing, and a despairing heart. You will live in constant suspense, filled with dread both night and day, never sure of your life. In the morning you will say, “If only it were evening!” and in the evening, “If only it were morning!”—because of the terror that will fill your hearts and the sights that your eyes will see. The Lord will send you back in ships to Egypt on a journey I said you should never make again. There you will offer yourselves for sale to your enemies as male and female slaves, but no one will buy you.

driving to the agugu show

guuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu

>>55114
Remember that Coco is racist as shit

>>55205
There's no difference between capitalism and feudalism, both are european inventions, and the only things relying on which we can distinguish capitalism and feudalism are… a historical period, technological advancement and agriculturism. Not to mention two of these things are such only partially.
>this more easily applies to you. you are jealous of the ruling class you think is jewish and want to replace it with a 100% white one, which you hope will include you
No, if my ruling class was white and ethnocentric (like me), then I would be a provincial NIMBY.

your supposed to share this thread with agugu, sharing is caring or however the leftist is collectivized

>>55246
gem

>>55246
Holy gemerald

>>55248
Big chungoog

>>55246
Truthnova that turned this shitty offsiter thread into ruins.

>>55247
capitalism and feudalism are not inventions, no one conciously sat down and decided that that was the way production would work and then had everyone agree. it was the result of historical development

>>55242
Unironically thinks non-whites descend from Adam award

>>55246
>coco is racist
explain this then

>>55254
Mymy looks Dutch as fuck

>>55122
I've met actual downies who are smarter than this

>>55254
Both were invented by the large racial organism and its racial genius, wigger.

>>55256
I guess it is a weird way of coping with her traumatic past.

stop bvmping the bait thread, it's making agugu sad……..

>>55261
i dont know how the fuck my shit ass bait thread reached 140 replies on a site thats almost jarty levels of dead

>>55262
right now the pph is 86, when i posted this it was at 0

>>55246
Maya is duginist doe

>>55262
its probably the second most active soy site

>>55252
Someone should replace that black's SA flag for White's flag SA flag

>>55262
xitter immigrants, 'cordists, and reelsfags rule the site nowadays, it's so over…

The most obvious bait of 2025 award.
Nevertheless, the most successful bait of 2025 award.

>>55265
Cut the probably

>>55265
soysphere as a whole is dying doe, a quick look at the shartys pph will tell you that. even ignoring pph, the sharty just feels empty when your posting. there arent as many raids, gemmy OCs, or major happening as there use to be

>>55266
Same, do it for her (ignore the asiatic facial features of the cosplayer)!

>>55262
There wasn't any other fun thread going on, so may as well talk in this one, simple as

>>55270
The passing of the great culture…

>>55270
tsmt

>>55272
fair enough, bait as obvious as this can still be gemmed up

>>55234
agugunvke

>>55275
do people here actually think agugu is a gem? i thought it was the zarty equivalent of spadeson posting and everyone hated it

by my estimate around all of the thread's replies are samefaggery, Zaryans wons, billions must listen to the VOC song

>>55278
AWABAG

>>55279
im the op and a ctrl+f shows me that 42 of this threads replies were me, so atleast 100 were actual zartycucks

>>55281
all 100 was me btw

>>55281
a third of the replies being you is genuinely fucking embarrassing, this is still a Zaryan victory

>>55278
Personally hate it

I even posted video of me it burning a few times.

>>55283
the majority of this thread of a sprawled out debate about race between me and 1 other guy lol, its not as if i only had a 1 to 3 bait to reply ratio

>>55278
Someone needs to read the 'ki page

>>55286
it is though, you're still sucking my BWC by replying to every sage I make

>>55289
why would you even sage on a website like this? it has a pph of like 3 if a thread is at the top of the 'log its staying for a week at least

>>55278
>i thought it was the zarty equivalent of spadeson posting and everyone hated it
left zarty in june award

>>55262
>>55265
>>55270
If you would consult the graph

>>55294
i was never on the zarty

>>55295
geg

>>55295
gem

>>55295
This is why we need to protect this website at all costs

>>55209
>race as we currently understand definitely is not the greatest framework for looking at genetics. the simple categories of "black", "white", "asian" etc. come nowhere close to providing an adequate lense for looking at genetic differences, because their socially constructed categories based on simple factors like skin tone, which are shared in population as disparate as sub-saharan africans and aboriginal australians
>socially constructed category
When you call a category a "socially constructed category", you imply there are some categories that are not socially constructed. It is not possible to have such a category, simply because categories are names belonging to a language about which there is (or isn't) a social consensus as to what they mean. Therefore, it makes no sense to use the term, unless you use it for its emotional salience, to label some categories as "fake" and other as "true".
>the simple categories of "black", "white", "asian" etc. come nowhere close to providing an adequate lense for looking at genetic differences
Obviously, full genome sequencing will give you more information about a person than just a racial label. It doesn't mean that there don't exist such groups as "black", "white" or "Asian" sharing common evolutionary history and thus exhibiting genetic and phenotypic similarities.
>categories based on simple factors like skin tone
Actually, they are based on genetic distances, skin tone (and other phenotypic features like skull shape, intelligence or propensity for violence) is just an evolutionary adaptation developed to deal with the features of environment a given population evolved in (like the intensity of sunlight) and as you have noticed yourself, different populations evolving in separate, but similar environments can develop similar phenotypes.

>>55300
Failquote, lurk moar

>>55301
STFU obsessed ligger
SAGE SAGE SAGE AND NOTHING BUT SAGE

>>55301
humanity has nowhere near the genetic diversity required for the sweeping racial superiority/inferiority arguments you are making, on average 2 random humans will share 99.99% of their dna

>>55302
nigger, where is the fail

>>55304
Calm down your clitty.
>on average 2 random humans will share 99.99% of their dna
What percent of DNA a random person shares with a cucumber (also random)?

>>55305
"Small" genetic distances make big differences. And yeah, not 99,9%, but 99,5-7% (depending on the group).
>ev&oe niggers have up to 20% of homo erectus admixture
>evendoe asians have a relatively significant denisovian admixture
>evendoe europeans have some neanderthal admixture
>whatever, sage the thread

>>55308
Cucumber? If you was a vegetable, you would be a cuckumber. Stop leaking, shitalo sister.

>>55310
marge

>>55306
>>55307
Diagnosis: nufags

>>55310
"If you were", ESL.

>>55312
im not new the point is most quotes here are like this but no one points it out

>>55310
>cuckumber
underrated thoughbeit

>>55315
It's a lost art…

>>55313
U wuz a de cuckumba yo pigskin

>>55256
Cleo likes being called a kaffir

Buddy this is the worst place you could have asked this question

>File (hide): 1703892292750.png (269.93 KB, 522x510, Sad_Spongebob.png)
>Why is this community so weird Zaryan 9 days ago No.2215 [Reply]
>I just wanna enjoy cute cartoon girls, why do ya'll have to slap nazis and wars and racism into everything
This thread.

>>55114
Holy clittyleak if you hate the Zaryans so much why don't you just go back to xitter instead of complaining about the "le heckin' chuds" on their OWN site? How retarded can you get? Sageing the bait thread, disgusting, truthfully.

successful bait, up

>>55114
Anyone with developed frontal robe will likely not care about /pol/ and racism, if they don't like the fact that the majority of the fan base are racist then they just got filtered from the community which is a good thing. personally I don't give a shit about racism but hang around anyway. so maybe it's a (you) problem.

>>55770
I don't have a developed frontal robe, what to do?

>>55771
Buy yourself one

>>55218
>and we're basically at war with the ongezellig 'cord and subreddits
wtf does this mean
genuinely

baited 197 people award