[ Home / Overboard / Stats ] [ g ] [ calm / brabant / drenthe / q / qa / zellig ] [ booru / wiki / club ] [ v ] [ Rules / Contacts ] [ Search ]
[ Register / Settings / Log in ]

Ongezellig

IAZ and soft NAZ

Thread list Index Catalog

ZWABAG
Quick reply [X]


[Return] [Thread list] [Index] [Catalog] [Bottom] | Replies: 199 | Views: 58 | Currently viewing: 1
Zaryan No.55226
File: 1784501891601.png (21.0 KB, 278x395, angelgugu.png)
this twead needs a gugu!
Zaryan No.55227
File: 1784501891601.png (580.0 KB, 1218x1066, hugehead.png)
guuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu
Zaryan No.55228
File: 1784501891601.gif (2.7 MB, 537x537, 3dgifmaker07274.gif)
gugugugugugugugu
Zaryan No.55229
File: 1784501891601.png (740.0 KB, 652x625, aihappy.png)
so happy to see all the gugus
Zaryan No.55230
>>55217
>would they be "nicer" to us?
Yes, the De Medici family were powerful bankers and made Florence thrive (same thing in every other Italian city-state). Jewish bankers instead were kicked 109 times over the course of millennias. Really makes you think
Zaryan No.55231
>>55219
>Then why the changeable features are more important than the inherent ones?
because these are the ones that actually influence our material conditions and the way we behave
>Why I can't call inherent and immutable interests of my blood "divine" and "high" compared to the interests which are formless and ever-changing?
hey you can believe whatever you want, you can believe that you're the son of zeus or whatever, doesnt stop me from calling you a retard for believing that.
Zaryan No.55232
File: 1784501891601.png (110.0 KB, 219x306, aguguparty.png)
this thread is now an aguguland.online colony, post your favorite googs
Zaryan No.55233
File: 1784501891601.png (1.1 MB, 801x719, 1736006784917-0.png)
GOOOOOOOOOOOOOOOG
Zaryan No.55234
File: 1784501891601-1.gif (2.7 MB, 282x282, pattern.gif)
File: 1784501891601-2.gif (2.7 MB, 282x282, pattern.gif)
File: 1784501891601-3.gif (2.7 MB, 282x282, pattern.gif)
File: 1784501891601-4.gif (2.7 MB, 282x282, pattern.gif)
agugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugugu
Zaryan No.55235
File: 1784501891601.png (27.0 KB, 500x250, 1735757765766.png)
Clean it up jangoog
Zaryan No.55236
File: 1784501891601.png (460.0 KB, 811x821, aguguland flag.png)
aguguland victory
Zaryan No.55237
File: 1784501891601.gif (1.9 MB, 1280x720, GUGUGUGUGUGUGU.gif)
GUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Zaryan No.55238
agugucord woke up
Zaryan No.55239
File: 1784501891601.gif (1.1 MB, 250x250, balls.gif)
>agugu
<agugu
^agugu
Zaryan No.55240
File: 1784501891601.png (38.0 KB, 500x250, 1735767988083.png)
Angry goog
Zaryan No.55241
File: 1784501891601.png (28.0 KB, 1315x132, ClipboardImage.png)
thread OP here, it seems that a seething spammer has arrived and ive been in this thread for way too long so i will be leaving. thanks for the argument though. reddit on!
Zaryan No.55242
>>55213
If you fully obey the Lord your God and carefully follow all his commands I give you today, the Lord your God will set you high above all the nations on earth. All these blessings will come on you and accompany you if you obey the Lord your God. You will be blessed in the city and blessed in the country. The fruit of your womb will be blessed, and the crops of your land and the young of your livestock—the calves of your herds and the lambs of your flocks. Your basket and your kneading trough will be blessed. You will be blessed when you come in and blessed when you go out. The Lord will grant that the enemies who rise up against you will be defeated before you. They will come at you from one direction but flee from you in seven. The Lord will send a blessing on your barns and on everything you put your hand to. The Lord your God will bless you in the land he is giving you. The Lord will establish you as his holy people, as he promised you on oath, if you keep the commands of the Lord your God and walk in obedience to him. Then all the peoples on earth will see that you are called by the name of the Lord, and they will fear you. The Lord will grant you abundant prosperity—in the fruit of your womb, the young of your livestock and the crops of your ground—in the land he swore to your ancestors to give you. The Lord will open the heavens, the storehouse of his bounty, to send rain on your land in season and to bless all the work of your hands. You will lend to many nations but will borrow from none. The Lord will make you the head, not the tail. If you pay attention to the commands of the Lord your God that I give you this day and carefully follow them, you will always be at the top, never at the bottom. Do not turn aside from any of the commands I give you today, to the right or to the left, following other gods and serving them.
Zaryan No.55243
However, if you do not obey the Lord your God and do not carefully follow all his commands and decrees I am giving you today, all these curses will come on you and overtake you. You will be cursed in the city and cursed in the country. Your basket and your kneading trough will be cursed. The fruit of your womb will be cursed, and the crops of your land, and the calves of your herds and the lambs of your flocks. You will be cursed when you come in and cursed when you go out. The Lord will send on you curses, confusion and rebuke in everything you put your hand to, until you are destroyed and come to sudden ruin because of the evil you have done in forsaking him. The Lord will plague you with diseases until he has destroyed you from the land you are entering to possess. The Lord will strike you with wasting disease, with fever and inflammation, with scorching heat and drought, with blight and mildew, which will plague you until you perish. The sky over your head will be bronze, the ground beneath you iron. The Lord will turn the rain of your country into dust and powder; it will come down from the skies until you are destroyed. The Lord will cause you to be defeated before your enemies. You will come at them from one direction but flee from them in seven, and you will become a thing of horror to all the kingdoms on earth. Your carcasses will be food for all the birds and the wild animals, and there will be no one to frighten them away. The Lord will afflict you with the boils of Egypt and with tumors, festering sores and the itch, from which you cannot be cured. The Lord will afflict you with madness, blindness and confusion of mind. At midday you will grope about like a blind person in the dark. You will be unsuccessful in everything you do; day after day you will be oppressed and robbed, with no one to rescue you. You will be pledged to be married to a woman, but another will take her and rape her. You will build a house, but you will not live in it. You will plant a vineyard, but you will not even begin to enjoy its fruit. Your ox will be slaughtered before your eyes, but you will eat none of it. Your donkey will be forcibly taken from you and will not be returned. Your sheep will be given to your enemies, and no one will rescue them. Your sons and daughters will be given to another nation, and you will wear out your eyes watching for them day after day, powerless to lift a hand. A people that you do not know will eat what your land and labor produce, and you will have nothing but cruel oppression all your days. The sights you see will drive you mad. The Lord will afflict your knees and legs with painful boils that cannot be cured, spreading from the soles of your feet to the top of your head. The Lord will drive you and the king you set over you to a nation unknown to you or your ancestors. There you will worship other gods, gods of wood and stone. You will become a thing of horror, a byword and an object of ridicule among all the peoples where the Lord will drive you. You will sow much seed in the field but you will harvest little, because locusts will devour it. You will plant vineyards and cultivate them but you will not drink the wine or gather the grapes, because worms will eat them. You will have olive trees throughout your country but you will not use the oil, because the olives will drop off. You will have sons and daughters but you will not keep them, because they will go into captivity. Swarms of locusts will take over all your trees and the crops of your land. The foreigners who reside among you will rise above you higher and higher, but you will sink lower and lower. They will lend to you, but you will not lend to them. They will be the head, but you will be the tail. All these curses will come on you. They will pursue you and overtake you until you are destroyed, because you did not obey the Lord your God and observe the commands and decrees he gave you. They will be a sign and a wonder to you and your descendants forever. Because you did not serve the Lord your God joyfully and gladly in the time of prosperity, therefore in hunger and thirst, in nakedness and dire poverty, you will serve the enemies the Lord sends against you. He will put an iron yoke on your neck until he has destroyed you. The Lord will bring a nation against you from far away, from the ends of the earth, like an eagle swooping down, a nation whose language you will not understand, a fierce-looking nation without respect for the old or pity for the young. They will devour the young of your livestock and the crops of your land until you are destroyed. They will leave you no grain, new wine or olive oil, nor any calves of your herds or lambs of your flocks until you are ruined. They will lay siege to all the cities throughout your land until the high fortified walls in which you trust fall down. They will besiege all the cities throughout the land the Lord your God is giving you. Because of the suffering your enemy will inflict on you during the siege, you will eat the fruit of the womb, the flesh of the sons and daughters the Lord your God has given you. Even the most gentle and sensitive man among you will have no compassion on his own brother or the wife he loves or his surviving children, and he will not give to one of them any of the flesh of his children that he is eating. It will be all he has left because of the suffering your enemy will inflict on you during the siege of all your cities. The most gentle and sensitive woman among you—so sensitive and gentle that she would not venture to touch the ground with the sole of her foot—will begrudge the husband she loves and her own son or daughter the afterbirth from her womb and the children she bears. For in her dire need she intends to eat them secretly because of the suffering your enemy will inflict on you during the siege of your cities. If you do not carefully follow all the words of this law, which are written in this book, and do not revere this glorious and awesome name—the Lord your God— the Lord will send fearful plagues on you and your descendants, harsh and prolonged disasters, and severe and lingering illnesses. He will bring on you all the diseases of Egypt that you dreaded, and they will cling to you. The Lord will also bring on you every kind of sickness and disaster not recorded in this Book of the Law, until you are destroyed. ou who were as numerous as the stars in the sky will be left but few in number, because you did not obey the Lord your God. Just as it pleased the Lord to make you prosper and increase in number, so it will please him to ruin and destroy you. You will be uprooted from the land you are entering to possess. Then the Lord will scatter you among all nations, from one end of the earth to the other. There you will worship other gods—gods of wood and stone, which neither you nor your ancestors have known. Among those nations you will find no repose, no resting place for the sole of your foot. There the Lord will give you an anxious mind, eyes weary with longing, and a despairing heart. You will live in constant suspense, filled with dread both night and day, never sure of your life. In the morning you will say, “If only it were evening!” and in the evening, “If only it were morning!”—because of the terror that will fill your hearts and the sights that your eyes will see. The Lord will send you back in ships to Egypt on a journey I said you should never make again. There you will offer yourselves for sale to your enemies as male and female slaves, but no one will buy you.
Zaryan No.55244
File: 1784501891601.jpeg (240.0 KB, 1000x1000, googincar.jpg)
driving to the agugu show
Zaryan No.55245
File: 1784501891601.png (870.0 KB, 1168x1240, crazygoog.png)
guuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu
Zaryan No.55246
File: 1784501891601.jpeg (95.0 KB, 950x913, GgEGuRya4AAU0yd.jpeg)
>>55114
Remember that Coco is racist as shit
Zaryan No.55247
>>55205
There's no difference between capitalism and feudalism, both are european inventions, and the only things relying on which we can distinguish capitalism and feudalism are... a historical period, technological advancement and agriculturism. Not to mention two of these things are such only partially.
>this more easily applies to you. you are jealous of the ruling class you think is jewish and want to replace it with a 100% white one, which you hope will include you
No, if my ruling class was white and ethnocentric (like me), then I would be a provincial NIMBY.
Zaryan No.55248
File: 1784501891601.png (34.0 KB, 838x532, sharingiscaring.png)
your supposed to share this thread with agugu, sharing is caring or however the leftist is collectivized
Zaryan No.55249
File: 1784501891601.png (730.0 KB, 722x720, ClipboardImage (32).png)
>>55246
gem
Zaryan No.55250
>>55246
Holy gemerald
Zaryan No.55251
File: 1784501891601.png (580.0 KB, 1812x2176, 1735500945284.png)
>>55248
Big chungoog
Zaryan No.55252
File: 1784501891601-1.jpeg (540.0 KB, 1908x1436, 1713003883180.jpeg)
File: 1784501891601-2.jpeg (120.0 KB, 800x793, 69210 - SoyBooru.jpg)
>>55246
Truthnova that turned this shitty offsiter thread into ruins.
Zaryan No.55254
>>55247
capitalism and feudalism are not inventions, no one conciously sat down and decided that that was the way production would work and then had everyone agree. it was the result of historical development
Zaryan No.55255
File: 1784501891601.png (77.0 KB, 1090x1200, 1730892915903.png)
>>55242
Unironically thinks non-whites descend from Adam award
Zaryan No.55256
File: 1784501891601.png (340.0 KB, 551x288, ClipboardImage.png)
>>55246
>coco is racist
explain this then
Zaryan No.55257
>>55254
Mymy looks Dutch as fuck
Zaryan No.55258
>>55122
I've met actual downies who are smarter than this
Zaryan No.55259
>>55254
Both were invented by the large racial organism and its racial genius, wigger.
Zaryan No.55260
>>55256
I guess it is a weird way of coping with her traumatic past.
Zaryan No.55261
stop bvmping the bait thread, it's making agugu sad........
Zaryan No.55262
>>55261
i dont know how the fuck my shit ass bait thread reached 140 replies on a site thats almost jarty levels of dead
Zaryan No.55263
>>55262
right now the pph is 86, when i posted this it was at 0
Zaryan No.55264
File: 1784501891601.png (1.6 MB, 1920x1080, ClipboardImage.png)
>>55246
Maya is duginist doe
Zaryan No.55265
>>55262
its probably the second most active soy site
Zaryan No.55266
>>55252
Someone should replace that black's SA flag for White's flag SA flag
Zaryan No.55267
>>55262
xitter immigrants, 'cordists, and reelsfags rule the site nowadays, it's so over...
Zaryan No.55268
The most obvious bait of 2025 award.
Nevertheless, the most successful bait of 2025 award.
Zaryan No.55269
>>55265
Cut the probably
Zaryan No.55270
>>55265
soysphere as a whole is dying doe, a quick look at the shartys pph will tell you that. even ignoring pph, the sharty just feels empty when your posting. there arent as many raids, gemmy OCs, or major happening as there use to be
Zaryan No.55271
File: 1784501891601.jpeg (120.0 KB, 621x1200, GgHJACoXcAAZa-r.jpg)
>>55266
Same, do it for her (ignore the asiatic facial features of the cosplayer)!
Zaryan No.55272
>>55262
There wasn't any other fun thread going on, so may as well talk in this one, simple as
Zaryan No.55273
File: 1784501891601.jpeg (71.0 KB, 1080x1619, 1733108750082.jpg)
>>55270
The passing of the great culture...
Zaryan No.55274
>>55270
tsmt
Zaryan No.55275
>>55272
fair enough, bait as obvious as this can still be gemmed up
Zaryan No.55276
File: 1784501891601.png (1.3 MB, 1183x951, agugunuke.png)
>>55234
agugunvke
Zaryan No.55277
>>55276
gemgugu
Zaryan No.55278
>>55275
do people here actually think agugu is a gem? i thought it was the zarty equivalent of spadeson posting and everyone hated it
Zaryan No.55279
by my estimate around all of the thread's replies are samefaggery, Zaryans wons, billions must listen to the VOC song
Zaryan No.55280
>>55278
AWABAG
Zaryan No.55281
>>55279
im the op and a ctrl+f shows me that 42 of this threads replies were me, so atleast 100 were actual zartycucks
Zaryan No.55282
>>55281
all 100 was me btw
Zaryan No.55283
>>55281
a third of the replies being you is genuinely fucking embarrassing, this is still a Zaryan victory
Zaryan No.55284
File: 1784501891601.mp4 (4.4 MB, 480x640, 1735506460115.mp4)

>>55278
Personally hate it

I even posted video of me it burning a few times.

Zaryan No.55286
>>55283
the majority of this thread of a sprawled out debate about race between me and 1 other guy lol, its not as if i only had a 1 to 3 bait to reply ratio
Zaryan No.55288
>>55278
Someone needs to read the 'ki page
Zaryan No.55289
>>55286
it is though, you're still sucking my BWC by replying to every sage I make
Zaryan No.55292
>>55289
why would you even sage on a website like this? it has a pph of like 3 if a thread is at the top of the 'log its staying for a week at least
Zaryan No.55294
>>55278
>i thought it was the zarty equivalent of spadeson posting and everyone hated it
left zarty in june award
Zaryan No.55295
File: 1784501891601.png (250.0 KB, 1065x604, Soyshoetheory.png)
>>55262
>>55265
>>55270
If you would consult the graph
Zaryan No.55296
>>55294
i was never on the zarty
Zaryan No.55297
>>55295
geg
Zaryan No.55298
>>55295
gem
Zaryan No.55299
>>55295
This is why we need to protect this website at all costs
Zaryan No.55300
>>55292
>why would you sage coal
Zaryan No.55301
>>55209
>race as we currently understand definitely is not the greatest framework for looking at genetics. the simple categories of "black", "white", "asian" etc. come nowhere close to providing an adequate lense for looking at genetic differences, because their socially constructed categories based on simple factors like skin tone, which are shared in population as disparate as sub-saharan africans and aboriginal australians
>socially constructed category
When you call a category a "socially constructed category", you imply there are some categories that are not socially constructed. It is not possible to have such a category, simply because categories are names belonging to a language about which there is (or isn't) a social consensus as to what they mean. Therefore, it makes no sense to use the term, unless you use it for its emotional salience, to label some categories as "fake" and other as "true".
>the simple categories of "black", "white", "asian" etc. come nowhere close to providing an adequate lense for looking at genetic differences
Obviously, full genome sequencing will give you more information about a person than just a racial label. It doesn't mean that there don't exist such groups as "black", "white" or "Asian" sharing common evolutionary history and thus exhibiting genetic and phenotypic similarities.
>categories based on simple factors like skin tone
Actually, they are based on genetic distances, skin tone (and other phenotypic features like skull shape, intelligence or propensity for violence) is just an evolutionary adaptation developed to deal with the features of environment a given population evolved in (like the intensity of sunlight) and as you have noticed yourself, different populations evolving in separate, but similar environments can develop similar phenotypes.
Zaryan No.55302
>>55300
Failquote, lurk moar
Zaryan No.55303
>>55300
>coal evendoe baitgem
Zaryan No.55304
>>55301
STFU obsessed ligger
SAGE SAGE SAGE AND NOTHING BUT SAGE
Zaryan No.55305
>>55301
humanity has nowhere near the genetic diversity required for the sweeping racial superiority/inferiority arguments you are making, on average 2 random humans will share 99.99% of their dna
Zaryan No.55306
>>55302
nigger, where is the fail
Zaryan No.55307
>>55302
>its a failquote if i hate you
Zaryan No.55308
>>55304
Calm down your clitty.
>on average 2 random humans will share 99.99% of their dna
What percent of DNA a random person shares with a cucumber (also random)?
Zaryan No.55309
>>55305
"Small" genetic distances make big differences. And yeah, not 99,9%, but 99,5-7% (depending on the group).
>ev&oe niggers have up to 20% of homo erectus admixture
>evendoe asians have a relatively significant denisovian admixture
>evendoe europeans have some neanderthal admixture
>whatever, sage the thread
Zaryan No.55310
>>55308
Cucumber? If you was a vegetable, you would be a cuckumber. Stop leaking, shitalo sister.
Zaryan No.55311
>>55310
marge
Zaryan No.55312
>>55306
>>55307
Diagnosis: nufags
Zaryan No.55313
>>55310
"If you were", ESL.
Zaryan No.55314
>>55313
>we wuz vegetables 'n shiet
Zaryan No.55315
>>55312
im not new the point is most quotes here are like this but no one points it out
Zaryan No.55317
>>55310
>cuckumber
underrated thoughbeit
Zaryan No.55319
>>55315
It's a lost art...
Zaryan No.55320
File: 1784501891601.jpeg (130.0 KB, 1170x1156, IMG_20240414_181324_688.jpg)
>>55313
U wuz a de cuckumba yo pigskin
Zaryan No.55355
>>55256
Cleo likes being called a kaffir
Zaryan No.55373
Buddy this is the worst place you could have asked this question
Zaryan No.55381
>File (hide): 1703892292750.png (269.93 KB, 522x510, Sad_Spongebob.png)
>Why is this community so weird Zaryan 9 days ago No.2215 [Reply]
>I just wanna enjoy cute cartoon girls, why do ya'll have to slap nazis and wars and racism into everything
This thread.
Zaryan No.55384
>>55114
Holy clittyleak if you hate the Zaryans so much why don't you just go back to xitter instead of complaining about the "le heckin' chuds" on their OWN site? How retarded can you get? Sageing the bait thread, disgusting, truthfully.
Zaryan No.55647
successful bait, up
Zaryan No.55653
Zaryan No.55712
Zaryan No.55770
>>55114
Anyone with developed frontal robe will likely not care about /pol/ and racism, if they don't like the fact that the majority of the fan base are racist then they just got filtered from the community which is a good thing. personally I don't give a shit about racism but hang around anyway. so maybe it's a (you) problem.
Zaryan No.55771
>>55770
I don't have a developed frontal robe, what to do?
Zaryan No.55779
>>55771
Buy yourself one
Zaryan No.56173
>>55218
>and we're basically at war with the ongezellig 'cord and subreddits
wtf does this mean
genuinely
Zaryan No.56261
baited 197 people award

[Return] [Thread list] [Index] [Catalog] [Top] | Replies: 199 | Views: 58 | Currently viewing: 1